Biostar

16,506 results • Page 2 of 331

design from protein-protein interfaces" and my PI has asked me to learn the basics of Structural bioinformatics over the summer so that I'll be able to start with my project as I begin my next semester(last week of July). Can...someone please suggest me top resources to learn the basics of structural bioinformatics. Though I have done projects in Genomics, and Systems biology, this will be my fir…

protein structural-bioinformatics

updated 11 months ago • iamakhilverma

Hi, I'm gonna start working on a machine learning project that concerns a bioinformatics issue (proteins, DNA, RNA,......, etc), but I don't know how

dna datasets rna proteins

updated 18 months ago • abdelmalek.benmeziane

Hello Everyone! I am newbie for programming to make bioinformatics pipeline. I would like to know basic steps or starting steps for bash scripting in nextflow. I would like to...say , how to start pipeline from QC to DEGs analysis

snakeflow python Nextflow

updated 16 months ago • Nai

to know if there are some jobs you can mostly work from home. I live in small country (Croatia) and bioinformatics jobs are very rare. I would like to find a bioinformatics freelance job and I don't know what kind of job to look...or what education do I need. I have a degree in biotechnology and I worked as a volunteer in one bioinformatics laboratory during my faculty where I gathered and analy…

python education

updated 14 months ago • Ivana

Hi, I know how to do NGS Analysis, but now I want to learn to develop new bioinformatics tools. What will be the best starting point? Thanks

software-development

updated 10 months ago • rse

Hello, I'm a senior in High School and I'm interested in bioinformatics and I'm thinking about participating in a science fair. I'm completely lost, I don't know where to start, or where...to look for research topics and I don't have a mentor. Can you please help me? How can I get started? and what are some resources for a high school student to find inspiration from for choosing a research to…

research

updated 22 months ago • Fahad.

Hi, We are establishing a bioinformatics core in our institution. The idea is to start with performing 1500 to 2000 whole exome sequencing a year, but...miRNA regulation, Genome variation, etc. ) the budget is not an issue , My Question is where to start with respect to equipment(hardware) , and staff. Thank you - Sara

genome next-gen sequencing core

updated 5.1 years ago • Sara

Hello! This is my first post here. I am a first-year medical student from Pakistan. I started med school 5 months ago and the more classes I have been taking, the more I am realizing that I am not into clinical medicine...in fields that require critical thinking in the way mathematics and Physics in A-Levels did. Here we start med school right after High School/ A Levels and graduate with an MBB…

MBBS career Masters Pakistan

updated 13 months ago • rija_khalid

Greetings Under the overarching framework of structural bioinformatics, a comprehensive understanding of basic proteomics is essential. Proteomics is the study of proteins on...ligand binding mechanisms. Furthermore, virtual screening, an integral component of structural bioinformatics, allows for the rapid and cost-effective identification of promising drug candidates from extensive chemical..…

Structural-Bioinformatics

updated 6 months ago • sriv.reetesh

Hi All, I'm starting a company called Stirplate.io which aims to automate data analysis for NGS. In my time as a researcher, I've found...Hi All, I'm starting a company called Stirplate.io which aims to automate data analysis for NGS. In my time as a researcher, I've found that a lot of biologists have a hard time working with NGS data considering they have no Linux background and no time to le…

software-error next-gen

updated 2.0 years ago • Keith

Hello :) I have a M.Sc. in Biology, and decided to move to the bioinformatics world. I'm teaching myself Python for a while, and started to work for a company that offers NGS services. My problem...is that I need the bioinformatic background. Does anyone can recommend on a specific book and/or really good online course/s? Appreciate your

next-gen

updated 6.6 years ago • Bella_p

Hi All, New bioinformatics course Bioinformatics Algorithms (Part 1) starts on Oct 21st 2013 at Cousera https://class.coursera.org/bioinformatics

course

updated 14 months ago • always_learning

I hold a master's degree in bioinformatics and I am just starting out my career in bioinformatics. I am only interested in working in industry and will...But I have heard from others that there is a ceiling for people with just a master's degree in bioinformatics. So if I stay in bioinformatics, will I ever be able to move up into management with just a master's degree

career

updated 13 months ago • kct913

Hello, I am a bioinformatics student I know some programming I have to prepare a presentation for the middle of the next week. In the Presentation...in a linear form. I Heard about latex for doing such things. But I really don't know from where to start I already installed texworks but my question is : Do I need to install something else ? Is there any place to start learning

dna

updated 10.6 years ago • Maria

I recently started using biblatex for authoring my papers, but I could not find a stylesheet yet that I can use for BMC Bioinformatics...Does such a stylesheet exist yet, or should I start hacking

updated 6.6 years ago • Egon Willighagen

Hi everyone, Hope everyone is good. I have the following dilemma. I hope to start my Masters in Bioinformatics in a few months. I am currently learning Python and also using the Biostars Handbook. I come...from a Biology background I am looking for Bioinformatics experience, however, the field is very new to my city, London and all the jobs require PhD and a few years of experience...My questi…

work-experience

updated 22 months ago • ishackm

Hello, I am an immunology student learning bioinformatics. I was searching to find the right answer for the problem I have but haven't found any concrete explanation...a public database. The excel file contains details regarding ProbeID, gene name, gene id, chromosome, start, end, snptype for the cell line of my interest. I wanna perform variant calling on this data and obtain the mutated sequen…

next-gen exome-seq RNA-Seq snp

updated 7.6 years ago • prathyushakonda

I am starting to explore amazon servicies to perform bioinformatics on illumina sequencing reads. Recently I read about Graviton2

genome assembly aws graviton2

updated 2.4 years ago • vm.higareda

Which Bioinformatic tools are available for sequence analysis of NRPS, adenylation domain recognition and start site specificities

NRPS NRPS analysis Domain prediction

updated 3.1 years ago • kittyatika

I am a student in data science and later I would like to get into bioinformatics. I have some experience with software development I would like to have a couple of portfolio projects as...I am a student in data science and later I would like to get into bioinformatics. I have some experience with software development I would like to have a couple of portfolio projects as a

software-development project

updated 15 months ago • d

Hi, I am a graduate (did masters) in Statistics. Now I am interested in bioinformatics. I do understand something of DNA /RNA seqences and gene expressions since I had bioinformatics courses during...Hi, I am a graduate (did masters) in Statistics. Now I am interested in bioinformatics. I do understand something of DNA /RNA seqences and gene expressions since I had bioinformatics courses during…

next-gen R statistics

updated 11 months ago • shanjida986

After all your experiences, how do you think is the best start for a novel, small bioinformatics unit? Do you think that a person with strong programming background (e.g., with an IT engineering...together with a senior scientist with a molecular biology degree, could make it, at least for a start? Perhaps is it also needed at least one member with experience in data mining and/or statistics? A…

core career

updated 14 months ago • Israel Barrantes

I started to work in the field of data analytics from a non-computer science background and I have a master's in IT with specializing...for the last couple of years. I feel like I need to get some more technical exposure to the field of bioinformatics and also a credential to prove that in order to go up in the career ladder. I would appreciate if you could suggest...some bioinformatics certifica…

certification courses

updated 15 months ago • digestize

I would like to make professional experience as a bioinformatics software developer. Perhaps contributing on GitHub to open source projects or contributing to cancer...I would like to make professional experience as a bioinformatics software developer. Perhaps contributing on GitHub to open source projects or contributing to cancer researches...Where do I start? Is networking enough

software-development

updated 16 months ago • d

value from genetic data. *We are open to all applications that have significant expertise in bioinformatics including current masters or doctoral students, postdocs and seasoned bioinformatics experts.* ## Job Description...Sequencing LLC is growing and we're seeking a **Director of Bioinformatics** and a **Senior Bioinformatics Developer** to join our team on either a contract or full-time bas…

NGS Open-Source Data-Analysis API

updated 23 months ago • Bioinformatics @ Sequencing LLC

Hi everyone, I'm a new phd student and struggling to analyse microarray data in R. If anyone could help it would be so appreciated. Thankyou!

differentially genes expressed microarray

updated 2.6 years ago • bioinformatics

I need some help, with courses (online and free), challenges etc

career

updated 12 months ago • caffrey

Hello all, I started my PhD in medicine this year, my research includes a lot -omics analysis. Currently I am doing a transcriptomics project...the further steps of pathway analysis (GO, GSEA etc.) and network analysis. Can anyone recommend a bioinformatics course (preferably real-life, somewhere in Europe) which I can follow to improve my bioinformatic skills. Of

Course

updated 2.5 years ago • Barista

Hi! I'm a software engineer willing to begin in the world of bioinformatics. But while i was searching for resources to learn the basics, I realized they're all oriented to biologists...in the field: which are the core concepts i should know and understand to begin learning bioinformatics? Which are the books i should start reading? Thanks in advance and sorry if someone did this question before

learning

updated 8.2 years ago • demarcoariel

I'm a junior in Molecular and Cell Biology major interested in the field of Bioinformatics, however, I don't have much knowledge on computer sciences or programming. I just finished my first year in...I'm a junior in Molecular and Cell Biology major interested in the field of Bioinformatics, however, I don't have much knowledge on computer sciences or programming. I just finished my first year in…

career

updated 11 months ago • SeYu

from people who went through the same thing and managed to get out of it, how did you do it? I started in the bioinformatics field recently, and I'm just starting to work with it. I love learning new things, but for every

advice

updated 3 months ago • sil_bioinfo

Hi everyone! Maybe it's a daft question, but I need help. How to start MrBayers in Windows? I've downloaded the archive and expanded it. In the manual I'm reading it's said "Start MrBayes by double

MrBayes

updated 2.8 years ago • Maria

and 4 years of postoctoral experience in molecular biology. A little more that one year ago, I started to be interested in bioinformatics and I realized I wanted to persue a career in this field. I had done the Bioinformatics...genomic data science specialization in coursera and learned Python and R. Now, I feel like I need to start to put hands on, in order to really get involved in the subject.…

Open-Source Beginners

updated 11 months ago • Eugenia84

Hi everyone, This is a naive attempt to start collating for the community some key proteomics bioinformatics pipelines and workflows. I am familiar with the work...of any other training resources / workflows beyond what is available in Bioconductor aimed at bioinformatics practitioners beginning to dive into proteomics? Thanks in advance, Sergio

proteomics workflows pipelines

updated 3.5 years ago • Sergio Martínez Cuesta

One of your project gave a result that was absolutly astonishing for you. I wonder what was your bioinformatics moment that you will never forget. To start mine: Programming a Hidden Markov Model for de novo gene prediction

updated 12.1 years ago • Fabian Bull

my PhD and planning for next stage of my career. The first half of my graduate years is pure bioinformatics basically analyze NGS data to look for genetic variation for certain diseases. Then the second half, based...on those variations I found I started to study the function which means all wet lab work, cell culture, RNA, transfection.... Two options for future (either postdoc...process patie…

career benchwork

updated 21 months ago • michealsmith

bioinformatics skills. I would comment that I am quite inexperience in bioinformatics analysis as I have only learned how...May I know any bioinformatics professional can recommend which one (most needed and complicated skills) should I explore more and do more...trainings/tutorials to get familiar with them? I have a long list of this tbh but idk where to start :') Besides, recently I've seen a…

postgraduate bioinformatics-skills

updated 15 months ago • pfee418

Hi all, Currently I have a Biology degree and the will of study a MSc on Bioinformatics. However, before starting the MSc (for several reasons) I decided to start a Professional Training (PT) on Programming...and how to build applications for business managment which I think won't be profitable for Bioinformatics. On the other hand, next year I could switch to Web App Dev (It's another PT) wher…

studies advice career

updated 2.3 years ago • edsanhu

Hi there, i have started my MS in Bioinformatics after 4 years and now I am too confused about how I should finalize my research project. Can

Bioinformatics research MS topic

updated 21 months ago • tehreemalii894

Hello everyone. I started looking for ways to improve my bioinformatics skills and found: 1. [Open Source Society University][1] - Path to a free self...taught education in Bioinformatics! 2. [A New Online Computational Biology Curriculum][2] 3. [An Online Bioinformatics Curriculum][3] However the OSSU...and many of the links from both papers are no longer available online. Therefore, two…

ossu course Curriculum

updated 11 months ago • Leite

GGTGTT CACCTACGTCATTTATGTAGGA Pathogenic Indel CASK:8573 SO:0001587|nonsense Starting with a chromosome and position, I am trying to get chrom Start and chrom End values I have single nucleotide base changes...insertions and deletions that can be multiple bases long. For Snps, i think i can write : chrom Start = pos and End = pos, because i have in another file like this : ( so …

chromosome end vcf start position

updated 23 months ago • it's

I am just starting to approach bioinformatics, I have some basic knowledge about mRNA, DNA, transcription, translation, etc. and computer...about) long non-coding RNA, etc. I want to find a book/ebook that can help me develop knowledge in bioinformatics. Something can be "theoretical" that can explain fundamental in biology and computer science. I need the one

book

updated 6.9 years ago • landscape95

I am a Master's degree student in a general Applied Biology program, and I just discovered Bioinformatics last semester. I did really well in class, and have been pursuing it in addition to my graduate research, which...one more semester before I graduate, and I am trying to figure out how I am going to get into the Bioinformatics field. I don't have any major research experience, though I excell…

PhD MS

updated 14 months ago • esskay

Hello all, I hope I've posted on the right section of the forum... I'll start my Msc in bioinformatics this year and I was wondering what courses I should add to my degree (Note: Msc here in Sweden is...Hello all, I hope I've posted on the right section of the forum... I'll start my Msc in bioinformatics this year and I was wondering what courses I should add to my degree (Note: Msc here in S…

education

updated 23 months ago • sor.hub.lennart

Hello everyone, Currently I'm in my 4th year of the bachelor bioinformatics at the HAN university of applied sciences, Netherlands. I'm looking for a foreign internship starting this...reading through them 1 by 1. Meanwhile, I'd like to ask if any of you might know if there are any bioinformatic internships in the field of marine biology (as I personally have an affinity with marine biology)? …

marine-biology internship undergraduate

updated 2.0 years ago • tchnl

Hi everyone, I'm gathering course materials for bioinformatics. These can be online pages, ebooks, videos, etc... Older ressources are listed in this 2010 post: https://www.biostars.org...p/10766/ I'll start with the obvious: - [Rosalind][1] (biological problem solving with code) - [The Biostar Handbook][2] (a comprehensive and always...up-to-date guide to bioinformatics) Thanks ! [1]: ht…

course teaching

updated 11 months ago • Carlo Yague

I was wondering if someone could suggest an interesting coding project for a beginner bioinformatics student. I am actually a senior computer science major, so my programming skills are pretty good. I have been...reading articles here and there but would like to do some hands on projects - just not sure where to start! Any advice is appreciated

project java

updated 12.5 years ago • And

Hello to everyone! I am considering starting a masters in bioinformatics next year. I also have to analyse some RNA-seq data for my current thesis study. I have minor

hardware

updated 16 months ago • tsomakiank

Sorry for posting this question, which is not about bioinformatics. I am not a native english speaker and I am often confused about the difference between the words *bioinformatic...and *bioinformatics*. For instance when used like: "I have experience with many different bioinformatics tools". Should I write *bioinformatic...or *bioinformatics* in this sentence? And when should I use the differ…

spelling

updated 11 months ago • jon.brate

Hi, I'm a graduate computer science student interested in researching visualization in bioinformatics and currently I'm working on visualizations using mainly D3 and Lively Web Server as development platform...I'm currently interested in open problems about web visualizations in bioinformatics in general. I have been working on genemaps viral visualizations. Can anyone give me some ideas about …

visualization

updated 21 months ago • vbazurto

16,506 results • Page 2 of 331

Recent Votes

A: Fold change - a final explanation

Answer: sc/snRNASeq using cell ranger parameters

mitochondria in single nuclear RNAseq

Answer: Association study using SNP data

Comment: agilent human all exon sureselct v7 bed file

Answer: install package

Comment: Overlap File for RACON Genome Polisher

Recent Locations • All